Meta tags:
author= GBIF Secretariat;
Headings (most frequently used words):
document, for, documents, gbif, documentation, the, setup, guidelines, authors, panel, and, asciidoctor, background, community, peer, review, process, translations, decommissioning, old, steering, technical, guidance, information, developers, colophon, other, formats, contribute, search, current, structure, operations, responsibilities, members, editors, system, software, new, suggested, citation, contributors, licence, persistent, uri, control, cover, image, structuring, writing, in, admonitions, extensions, to, outstanding, issues, source, code, versions, translated, publishing, generating, local, build, jenkins, translation, po4a, crowdin, text, chapters, headings, top, level, heading, inline, markup, terms, table, cell, wrapping,
Text of the page (most frequently used words):
the (241), and (93), gbif (72), for (60), #document (59), this (45), with (36), translation (32), secretariat (31), #documents (30), org (29), documentation (26), file (26), asciidoctor (25), are (24), adoc (22), text (22), https (21), doc (20), will (20), build (20), doi (18), translations (18), github (18), community (18), new (16), that (16), you (16), source (15), can (15), from (15), using (15), copenhagen (14), complete (14), 2020 (13), index (13), status (13), code (13), authors (13), markup (13), update (12), also (12), guidance (12), guide (12), repository (11), use (11), asciidoc (11), git (11), not (11), versions (11), system (11), lang (10), section (10), such (10), files (10), work (10), 35035 (9), guidelines (9), set (9), crowdin (9), add (9), user (9), po4a (9), should (9), data (9), process (9), version (8), some (8), template (8), have (8), either (8), make (8), pdf (8), review (8), about (8), chapter (8), panel (8), biodiversity (8), spanish (8), all (7), branch (7), any (7), information (7), technical (7), software (7), language (7), then (7), here (7), used (7), link (7), how (7), provides (7), french (7), pot (6), change (6), create (6), old (6), these (6), jenkins (6), job (6), need (6), both (6), there (6), open (6), server (6), available (6), their (6), example (6), which (6), when (6), other (6), paragraph (6), format (6), more (6), members (6), current (6), under (5), name (5), first (5), ensure (5), setup (5), 100 (5), conf (5), users (5), see (5), just (5), existing (5), including (5), html (5), provide (5), docker (5), tools (5), your (5), level (5), docs (5), publishing (5), translators (5), part (5), each (5), url (5), future (5), practice (5), reference (5), staff (5), our (5), reviewers (5), 15468 (5), updated (4), select (4), log (4), type (4), 200 (4), they (4), changes (4), local (4), versioned (4), out (4), builds (4), does (4), matter (4), within (4), command (4), development (4), top (4), would (4), same (4), approach (4), web (4), needed (4), english (4), include (4), needs (4), allows (4), multiple (4), effective (4), 2019 (4), like (4), issues (4), table (4), break (4), dwc (4), formatting (4), continue (4), note (4), one (4), heading (4), structure (4), paula (4), zermoglio (4), experts (4), through (4), support (4), communities (4), peer (4), programme (4), 2021 (4), ongoing (4), john (4), wieczorek (4), via (3), licensed (3), image (3), control (3), persistent (3), license (3), contributors (3), configuration (3), browser (3), project (3), required (3), appropriate (3), branches (3), utf (3), based (3), syntax (3), check (3), management (3), edit (3), developers (3), rebuild (3), well (3), may (3), what (3), problem (3), possible (3), spelling (3), warnings (3), than (3), translated (3), exist (3), uses (3), nodes (3), images (3), form (3), editors (3), style (3), has (3), dna (3), cell (3), width (3), between (3), terms (3), special (3), standard (3), reading (3), admonitions (3), past (3), trends (3), guarantee (3), performance (3), single (3), string (3), become (3), paragraphs (3), side (3), headings (3), signs (3), title (3), two (3), line (3), below (3), easier (3), commissioned (3), intended (3), recommendations (3), informatics (3), annual (3), steering (3), volunteer (3), its (3), communication (3), while (3), help (3), improve (3), portuguese (3), best (3), practices (3), georeferencing (3), arthur (3), chapman (3), head (2), detached (2), 2023 (2), utc (2), egyptian (2), paperplant (2), chapultepec (2), mexico (2), city (2), photo (2), 2016 (2), alfonso (2), gutiérrez (2), aldana (2), inaturalist (2), research (2), grade (2), observations (2), cyperus (2), papyrus (2), cover (2), 5xs6 (2), hm38 (2), uri (2), licence (2), kyle (2), copas (2), laura (2), russell (2), suggested (2), citation (2), colophon (2), service (2), private (2), integration (2), authentication (2), push (2), point (2), must (2), added (2), before (2), setting (2), publisher (2), merge (2), usr (2), bin (2), deploy (2), updating (2), specific (2), things (2), across (2), full (2), individual (2), token (2), test (2), published (2), retained (2), links (2), readme (2), beginning (2), course (2), maintaining (2), every (2), time (2), changed (2), resulting (2), output (2), problems (2), computer (2), recent (2), error (2), being (2), generated (2), finished (2), webserver (2), consistent (2), chosen (2), following (2), several (2), small (2), interface (2), release (2), uat (2), broken (2), most (2), easily (2), pull (2), means (2), rather (2), but (2), editor (2), similar (2), where (2), portable (2), object (2), without (2), additional (2), steps (2), filenames (2), shown (2), commonly (2), translating (2), identifier (2), others (2), stored (2), managed (2), commercial (2), plain (2), tables (2), apply (2), sequence (2), contents (2), only (2), term (2), decimallatitude (2), eventdate (2), looks (2), www (2), hyperlinks (2), followed (2), brackets (2), appear (2), constant (2), environment (2), monospaced (2), word (2), bolded (2), conventions (2), equals (2), unique (2), directly (2), above (2), written (2), manual (2), blank (2), common (2), writing (2), write (2), wikipedia (2), article (2), 300 (2), primary (2), called (2), large (2), sections (2), editing (2), detailed (2), comprehensive (2), lightweight (2), writer (2), anne (2), dmitry (2), schigel (2), maofang (2), luo (2), asia (2), chair (2), high (2), quality (2), serves (2), widely (2), responsibilities (2), consists (2), subject (2), operations (2), coordination (2), previous (2), earlier (2), metadata (2), datacite (2), zenodo (2), deposit (2), produce (2), decommissioning (2), details (2), efforts (2), making (2), please (2), email (2), free (2), materials (2), important (2), comments (2), ones (2), general (2), editorial (2), maintained (2), corrections (2), ensuring (2), focus (2), fostering (2), implementation (2), plan (2), 2017 (2), maria (2), anders (2), impact (2), david (2), bloom (2), aim (2), global (2), background (2), last, july, creative, commons, attribution, sharealike, unported, matthew, blissett, figure, save, two_letters_code, thus, avoiding, awkward, abbreviation, i18n, translation_, branchname, tab, admin, rights, generate, automated, requires, po_directory, options, opt, add_, commit, committed, invalid, post, action, script, true, advanced, settings, supports, origin, parameter, receive, payload, discard, been, copied, events, releases, pushes, secret, xxxxxxxxxxxx, buildwithparameters, xxxxxxxxxx, webhook, path, something, triggers, paths, unversioned, appropriately, etc, training, powers, end, continuous, assuming, subdirectories, coded, clues, run, pwd, toolkit, familiar, own, useful, previewing, terminal, window, navigate, directory, kept, preventing, inspect, contains, list, errors, converted, into, tool, made, notified, retrieves, generates, languages, copies, formatted, generating, result, mostly, contained, container, apache, serve, compilation, spell, checking, gnu, aspell, essentially, reasoning, kicad, combine, linux, incomplete, crossreferences, incorrect, accessed, button, requests, publish, building, recommended, methods, conflict, lost, mess, confusing, sort, replace, examples, website, poeditor, poedit, choose, option, copy, danish, translate, desktop, instead, alternatives, request, merged, detect, notify, whenever, warn, present, why, entry, websites, done, edits, correcting, many, tutorials, offline, submit, comment, flag, address, outdated, misspellings, seen, com, assets, comprises, possibly, involving, assigning, dois, custom, demonstrate, embedding, alternative, outstanding, stretch, beyond, page, tcta, atta, tctatcctcaattataggtcataattcaccatcagtagatttaggaattttctctattcatattgcaggtgtatcatcaattataggatcaattaattttattgtaacaattttaaatatacatacaaaaactcattcattaaactttttaccattattttcatgatcagttctagttacagcaattctccttttattatcatta, applying, role, wrap, position, words, wrapping, darwin, core, definition, recognizes, additions, extensions, covers, bulleted, numbered, lists, block, short, sentence, renders, call, supplemental, notes, tips, cautions, visit, external, sources, containing, bracketed, clickable, print, actual, parenthesis, refer, program, elements, variable, function, names, databases, types, variables, statements, keywords, grave, accent, sign, emphasize, phrase, asterisk, bold, underscore, character, marks, italics, _italic_, typographical, explanations, inline, lower, highest, three, readers, appears, mouse, hovers, over, unique_chapter_id, begins, begin, preceded, good, always, surrounded, double, chapters, necessary, sure, aren, spaces, indentations, second, regular, space, parts, excellent, among, books, ebooks, wiki, adding, changing, deleting, was, presumably, later, 250, 400, except, hard, restrictions, structured, probably, easiest, number, prefixed, preferably, intervals, allow, inserted, whose, start, spread, makes, especially, collaborative, helps, simplifies, reordering, directive, structuring, basic, orientation, much, references, liaisons, andrea, hahn, chantal, huijbers, oceania, latin, american, caribbean, pierre, radji, africa, patricia, mergen, europe, central, vice, sharon, grant, north, america, participate, vetting, audiences, regarding, sustainability, consult, institutions, initiatives, projects, considering, updates, assist, priorities, calls, comprised, individuals, regions, meets, quarterly, discuss, commissioning, priority, group, oversight, selection, searching, retrieve, older, longer, manage, often, case, urls, plural, permanently, discoverable, achieves, key, goals, 80925, resolve, assigned, archival, register, provided, already, decommission, remove, series, interested, implements, relevant, expressed, interests, welcome, extend, usefulness, reach, wish, voice, titles, gauge, interest, network, hosts, who, actively, reduce, linguistic, barriers, commission, views, strategically, lack, capacity, them, vibrant, questions, concerns, specifically, overall, gentle, introduction, pulled, few, give, flavour, however, resources, require, learning, relatively, simple, understand, edited, tracking, efficient, outputs, automatically, convenience, content, tracked, worry, because, british, endings, yse, ize, united, nations, learn, reviewer, resolved, timely, fashion, agreement, contributions, properly, credited, acknowledged, commits, operational, principles, transparency, effectiveness, freely, openly, public, repo, enables, raise, track, resolution, offer, suggestions, stage, life, cycle, access, accurate, starts, premise, fact, identities, concealed, during, encouraged, toward, honest, collegial, exchanges, constructive, criticism, even, difference, opinion, ways, benefit, broader, responsible, actions, encourage, safe, hospitable, productive, professional, respectful, harassment, participating, adherence, conduct, step, digital, workflow, opportunity, beneficiaries, offering, direct, input, feedback, foremost, mechanism, discussion, collaboration, 2015, 6yp9, 9885, communications, strategy, bpdx, ae08, simplified, chinese, eliza, zschuschen, p93g, te47, advancing, catalogue, world, natural, history, collections, matt, woodburn, barbara, thiers, patrick, semal, tim, robertson, deborah, paul, quentin, groom, alex, asase, donald, hobern, z79c, sa53, establishing, participant, node, concepts, considerations, vf1a, nr22, derived, platforms, cecilie, svenningsen, prager, henrik, nilsson, daniel, lundin, urmas, kõljalg, thomas, jeppesen, michael, hope, marie, grosjean, frode, fossøy, finstad, andrew, bissett, andersson, companies, publishers, internal, authorization, b8hq, me03, dairo, escobar, dag, endresen, rukaya, johaadien, sophie, archambeau, tainan, messina, katia, cezón, miguel, vega, cristina, villaverde, pedro, beja, rui, figueira, 5xdm, 8762, environmental, assessments, iaia, international, association, assessment, versión, gzjg, af18, guía, para, limpieza, datos, sobre, biodiversidad, con, openrefine, leonardo, buitrago, ricardo, ortiz, gallego, camila, plata, corredor, gdwq, 3v93, calculator, e09p, h128, quick, celeste, luna, gg7h, s853, 5jp4, 5g10, generalizing, sensitive, species, occurrence, goal, reliable, reusable, instilling, trust, wider, adoption, team, started, coordinating, engaging, vertnet, facility, long, produced, range, topics, relating, supporting, search, issue, contribute, formats,
Text of the page (random words):
ve their work in ways that benefit the broader biodiversity informatics community community members are responsible for ensuring that their actions encourage a safe hospitable and productive environment that is professional respectful and harassment free for all participating in adherence with the gbif code of conduct each document s source text is freely and openly available and maintained in a public github repository or repo the use of github enables reviewers and users to raise issues and track their resolution reviewers and users can offer comments suggestions and corrections at any stage of the document s life cycle making it easier to make corrections to current versions and update future ones while ensuring community access to accurate well maintained guidance and information staff from the gbif secretariat commits to two operational principles to ensure the transparency and effectiveness of the community review process individual contributions by community members will be properly credited and acknowledged open issues will be resolved in timely fashion either by the authors or by secretariat staff in agreement with the authors learn how to help improve these documents as a community peer reviewer 2 guidelines for document authors we code documents in this system using a lightweight code called asciidoc we apply united nations editorial style conventions and spelling tl dr british english with ize and yse endings we use asciidoc because it means that authors need not worry about maintaining formatting changes to both the document s content and structure can be tracked and managed using general tools the same source files can produce multiple outputs automatically such as html and as a convenience pdf the management and tracking translations is easier and more efficient while this system does require learning some new tools the ones we have chosen are widely used in the publishing software development and translation communities asciidoc is also relatively simple to work with and understand if you ve written or edited a wikipedia article you ll have no problem with this format we ve pulled out details for a few of the more common uses of asciidoc markup in the technical guidelines below to give you a flavour of it however two resources provide more detailed guidance the asciidoc writer s guide which provides a gentle introduction to the format the asciidoctor user guide which provides a comprehensive reference on how to work with this language if you have questions comments or concerns either specifically about asciidoc or about the overall use and approach of this format please email us at communication gbif org 3 translations the gbif network hosts a vibrant community of volunteer translators who work actively to reduce linguistic barriers to free and open biodiversity data we also commission commercial translation of our materials when the secretariat views such efforts as strategically important and or our existing language communities lack the capacity to complete them we support translations based on the expressed needs and interests of our language communities as such we welcome efforts to extend usefulness and reach of our documentation through translation if you wish to volunteer or to voice your support for making specific titles available in translation please email us at communication gbif org we will do what we can gauge interest from others in the community and provide coordination support if you re interested in the details of how our documentation system implements translations see the relevant section in the technical guidance below 4 decommissioning old documents as a matter of practice the secretariat will decommission and remove earlier versions of documents from gbif through the following series of steps register a gbif doi via datacite for the previous version of the document provided that one does not already exist produce an archival standard version pdf a of the document or documents if translations are available deposit the file s in zenodo with the assigned doi update the datacite metadata to resolve the doi to the new zenodo deposit include a reference to the earlier version in the current document s metadata on gbif org e g https www gbif org document 80925 this approach achieves several key goals previous versions will be permanently discoverable using a persistent identifier gbif will no longer have to manage either the old file or its url or as is more often the case urls plural users searching on gbif org will retrieve only the current documents which then reference older versions 5 documentation steering panel the steering panel consists of a volunteer group of experts that in coordination with gbif secretariat staff provides oversight and guidance for the selection and community review of gbif documentation 5 1 structure and operations the panel consists of 8 10 members comprised of individuals from gbif regions and the secretariat staff the panel meets no more than quarterly to discuss existing documentation and to provide recommendations to the gbif secretariat on commissioning high priority guidance from subject matter experts 5 2 responsibilities assist with setting annual priorities for documentation needs and make recommendations for calls for documentation as and when appropriate consult widely with other experts institutions initiatives and projects within the biodiversity informatics community at large when considering updates to and for new documentation review and make recommendations regarding the documentation system for future sustainability participate in the vetting process to ensure that commissioned documentation is of high quality and serves the intended audiences 5 3 panel members chair sharon grant north america vice chair patricia mergen europe and central asia pierre radji africa maofang luo asia paula zermoglio latin american and the caribbean chantal huijbers oceania andrea hahn gbif secretariat dmitry schigel gbif secretariat gbif secretariat staff liaisons kyle copas laura anne russell 6 technical guidance 6 1 for authors this section provides some basic technical orientation for authors commissioned to write documents both the asciidoc writer s guide and asciidoctor user guide provides much more detailed and comprehensive references for how to work with this lightweight markup format structuring the document all documents whose primary language is english start from the file index en adoc using the include directive allows a single document to be spread across multiple files this makes editing especially collaborative editing easier helps translators and simplifies reordering sections of a document except for the primary file being called index en adoc there are no hard restrictions on how a document must be structured it is probably easiest for editors to structure documents with number prefixed filenames preferably with large intervals to allow new sections to be inserted index en adoc 100 en adoc 200 en adoc 250 en adoc 1 300 en adoc 400 en adoc 1 this file was presumably added later between 200 and 300 see the section on translating documents when adding changing or deleting document files writing in asciidoctor asciidoctor is a text document format for writing among other things books ebooks and documentation it is similar to wiki markup if you can write a wikipedia article then you ll have no problem with asciidoctor asciidoctor user guide the asciidoctor user guide provides an excellent reference to what s possible with asciidoctor here are the most common parts of asciidoctor markup text regular paragraph text does not need any special markup in asciidoctor just add a blank line both above and below each paragraph and the first word in the paragraph should not have a space before it here are some example paragraphs in asciidoctor this is an example paragraph written in asciidoctor see it s just plain text no special markup necessary do make sure there aren t spaces or manual indentations at the beginning of your paragraph text this is a second example paragraph in asciidoctor note that there s a line break and a blank line between paragraphs chapters and headings the top of each chapter file should begin with a chapter title preceded by two equals signs it s good practice to always include a unique id string above the chapter title surrounded in double brackets for example unique_chapter_id chapter title chapter text begins here the unique id string is used to link directly to a chapter or section such as this link to this section readers can also link directly to a section by using the link that appears when the mouse hovers over a chapter heading top level heading within a chapter the first and highest heading level uses three equals signs top level heading lower level headings continue with additional signs continue reading about section headings in the asciidoctor user guide inline markup here are some standard typographical conventions with explanations of how they re commonly used _italic_ one underscore character on either side of text marks it as italics in asciidoctor bold bolded text is used to emphasize a word or phrase the asciidoctor markup is one asterisk on either side of the text to be bolded constant width constant width or monospaced text is used for code as well as within paragraphs to refer to program elements such as variable or function names databases data types environment variables statements and keywords the asciidoctor markup is one grave accent sign on either side of the text to monospaced hyperlinks for hyperlinks to external sources just add the full url string followed by brackets containing the text you d like to appear with the url the bracketed text will become a clickable link in web versions in print versions it will appear in the text followed by the actual url in parenthesis the markup looks like this visit https www gbif org gbif org continue reading about text formatting in the asciidoctor user guide admonitions asciidoctor allows authors to call out supplemental admonitions in the form of notes tips warnings and cautions for a note the markup looks like this note past trends are no guarantee of future performance and here s how it renders past trends are no guarantee of future performance there is also a short form which is appropriate for a single sentence note past trends are no guarantee of future performance continue reading about admonitions and other block formatting in the asciidoctor user guide the guide also covers other formatting such as bulleted or numbered lists tables and images 6 1 1 gbif extensions to asciidoctor the document system recognizes some small additions to standard asciidoctor markup terms terms including darwin core terms can be shown in a special style and with a link to the definition as decimallatitude or dwc eventdate term dwc decimallatitude or term dwc dwc eventdate table cell wrapping by applying the role break all the contents of a table cell will break wrap at any position rather than only between words dna sequence example tctatcctcaattataggtcataattcaccatcagtagatttaggaattttctctattcatattgcaggtgtatcatcaattataggatcaattaattttattgtaacaattttaaatatacatacaaaaactcattcattaaactttttaccattattttcatgatcagttctagttacagcaattctccttttattatcatta the markup is break all tcta atta without it the dna sequence would stretch the table cell beyond the width of the page 6 1 2 outstanding issues demonstrate embedding an image and alternative translated images doc effective nodes guidance has this apply a custom style to the document doc effective nodes guidance also has this document a release process possibly involving assigning dois 6 2 for editors 6 2 1 document source code the plain text files and other assets images data tables that form each document comprises the source code these source files are stored in a git repository which for gbif is managed by a commercial service github the source code for this document is stored at https github com gbif doc documentation guidelines the source code for this part of the document can be seen here contributors can edit the source code either in a web browser using the github interface or on a computer including when offline using git they may also submit issues that comment or flag problems for others to address including outdated information broken links misspellings and the like many tutorials for using both git and github are available on the web 6 2 2 document versions some documents are published as multiple versions this is done using branches in git the name of the branch such as 1 0 or 2019 is the identifier for the version this allows for edits to old versions such as updating a link or correcting a syntax error in the document the version branch name is used as part of the url for the document e g https docs gbif org effective nodes guidance 1 0 this allows for multiple versions to be retained on the webserver 6 2 3 translated documents the translation system uses po portable object files which are commonly used for translating software and websites a file po4a conf needs to exist as shown in translation setup po4a each en adoc file needs an entry in po4a conf type asciidoc 100 en adoc lang 100 lang adoc the build system will warn if any en adoc files are not present in po4a conf this is why the readme adoc and license adoc files not part of the document do not include en in their filenames whenever the document text is changed the build server will update the translation template file translations index pot with the source english text crowdin will detect the change to translations index pot and notify translators as translators add translations to the text crowdin will make a pull request on the repository this should be merged the build server will then rebuild the document with the translated text alternatives to crowdin it is also possible to translate documents without crowdin using desktop tools instead the translators then need to use git github these additional steps are needed for a new language copy the generated index pot portable object template file to the new file xx po where xx is the language code for example this would be da po for a danish translation to update a translation open the xx po file in a po file editor and choose the option to update from pot file or similar use a po file editor to make the translations examples are poedit software or poeditor website use git github to replace the old translation file with your updated translation file push the changes and the build server will rebuild the document it is not recommended to use both methods on the same document if translations conflict they would not be lost but the resulting mess can be confusing to sort out using git 6 2 4 publishing a document here publishing a document means building the document for docs gbif org rather than the test system docs gbif uat org to publish a document go to the github repository in a web browser if required review a...
|