Meta tags:
description=The brainrot is rotting, someone spilt DC and Marvel in there He/They my dudes :];

Headings (most frequently used words):

spin, dumpster, fire, jason, todd, peter, parker, masterlist,

Text of the page (most frequently used words):
the (51), and (44), mar (22), sp1n (19), dle (19), his (19), peter (18), reblogged (16), follow (16), was (14), jason (14), when (13), with (13), just (11), that (11), for (11), new (11), 2014 (10), but (10), all (9), spider (9), red (9), this (8), mode (8), one (8), him (8), feb (8), you (7), not (7), 2025 (7), now (7), existential (7), crisis (7), parker (7), oct (6), russia (6), jan (6), them (6), luciaintheskyainthi (6), there (6), they (6), things (5), please (5), what (5), name (5), have (5), will (5), time (5), can (5), apr (5), has (5), hood (5), may (5), squidge (5), are (4), using (4), make (4), moth (4), nudes (4), tumblr (4), 2019 (4), someone (4), doesn (4), had (4), little (4), universe (4), life (4), man (4), gotham (4), how (4), some (4), out (4), guy (4), comic (4), onyxmistkes (4), last (3), art (3), domestic (3), silk (3), friendly (3), back (3), only (3), post (3), because (3), miss (3), been (3), while (3), were (3), into (3), people (3), change (3), let (3), another (3), where (3), from (3), like (3), won (3), place (3), todd (3), team (3), always (3), then (3), get (3), more (3), maybe (3), did (3), sick (3), fucking (3), fic (3), never (3), walter (3), host (3), archives (3), other (3), work (2), thoughts (2), well (2), fuck (2), sends (2), thought (2), reblog (2), every (2), goddamn (2), find (2), jun (2), illegal (2), 2017 (2), blue (2), guys (2), send (2), she (2), since (2), these (2), 59k (2), knows (2), thrown (2), world (2), meets (2), say (2), takes (2), whole (2), fixing (2), far (2), starts (2), over (2), down (2), wasn (2), everyone (2), again (2), sent (2), living (2), 20k (2), criminal (2), cute (2), two (2), mid (2), good (2), decides (2), problem (2), its (2), does (2), know (2), something (2), finds (2), city (2), same (2), through (2), straight (2), felt (2), would (2), around (2), don (2), way (2), after (2), though (2), bad (2), himself (2), works (2), shit (2), damn (2), dumpster (2), travel (2), instead (2), legally (2), big (2), neighborhood (2), book (2), who (2), day (2), read (2), inspired (2), written (2), tomorrow (2), depeche (2), jayroy (2), recommend (2), fanworks (2), very (2), willing (2), nsfw (2), org (2), lots (2), part (2), really (2), keep (2), great (2), run (2), still (2), nonprofit (2), ao3 (2), fanart (2), images (2), imgur (2), reference (2), nnahs (2), unsupported, browser, might, intended, sure, latest, version, edge, safari, firefox, chrome, 389, 702, 352, 772, 922, nov, shower, responder, kingofkaumidy2, fantasylover4538, banned, yoink, doink, being, scp, threats, gif, kalazin, willifolts, image, source, closest, match, bmn4, cell, dna, chromosome, sequence, common, bombyx, mori, string, identified, atgctactttaatcaaaaattcatattattatttgaagtcaacattaaataattgaatctgtgattaaacttg, hellsitegenetics, piece, history, blog, wondering, deactivated, dash, dovahdez, seen, screenshots, earthnicity, makes, roomba, knives, taped, wtf, sisters, eyeball, thanks, obama, aug, maradaisykat, tree, squirrel, reminder, 2015, kyloschuyler, favorite, her, eyes, dared, danger, happened, here, jaxon, flaxon, waxon, onwardwall, thegingerbalrog, ilovepretzelrods, dismantlerepaired, thackery, hikingnerd, asks, about, your, nuclear, plans, timelordpillbug, objectify, women, expect, straighthater, says, amerlcanapparel, deactivated2020, ra1nydayss, 618, roomates, totally, losers, lot, fun, colors, jiloop, deception, killing, emotions, downfall, happens, try, child, assassin, too, flipped, upside, thing, stays, ability, fix, 83k, enough, erase, minds, magic, forever, ensure, break, future, away, called, home, trying, best, crime, alley, managing, enterprise, expecting, invite, wickedly, smart, tenant, series, surprises, caught, problems, accidental, trip, york, air, near, argument, definitely, end, admitting, bug, reflexes, deadpool, shows, material, refuses, take, answer, thinks, cannot, annoying, clumsy, dorky, weirdly, strong, shaped, flags, webbed, disasters, join, rouges, mention, finding, mists, bats, birds, photographer, job, lead, making, friend, 131k, waking, self, memory, got, question, shutterbug, suffers, consequences, batfam, laughing, pain, 19k, sexual, dimorphism, difference, between, different, sexes, species, spiders, females, larger, quarter, sees, first, instinct, brain, screaming, mate, study, cult, cue, family, misunderstandings, conspiracies, cults, wild, interesting, deal, finally, relief, random, yorker, room, portal, lsd, daydream, telling, artemis, told, saying, true, justify, keeping, three, weeks, bored, lonely, needed, need, anymore, 279k, alone, erasure, dreading, upcoming, month, getting, isn, build, real, visits, bar, wants, acknowledge, existence, look, eye, exists, tries, tell, friends, surprising, goes, luck, doctor, strange, webs, rocket, lunchers, found, unconscious, injured, accidentally, inventing, multiverse, pride, deflated, quickly, mulled, turning, mind, 107k, riding, 36k, ends, character, lay, low, hero, create, civilian, identity, anthony, mayson, live, until, somehow, catches, attention, wayne, crashes, mundane, leaving, cracks, fragile, mask, normality, mechanic, fanfic, ongoing, complete, masterlist, cosmaris, 328, 473, hallucination, jaybin, lilsnuffklins, 821, their, dumbassary, 878, 116, supposed, preparing, presentation, today, wanted, practice, lip, syncing, volume, warning, spotify, ball, kick, moment, listening, having, experience, 982, 288, hour, delusion, hazzymayy, 440, 837, use, stargazing, enby, those, younguns, crowd, erotic, especially, slash, welcome, many, places, haven, 1994, various, hosted, large, compared, necessary, fannish, ecosystem, glad, structure, system, running, beyond, donate, money, help, going, long, expanded, grown, board, everything, maintain, old, sites, static, multifandom, archive, code, squidgeworld, also, podfics, beatrice, otter, reading, yes, quartz, key, holy, blast, past, batman, remember, even, looking, site, eons, ago, blogquantumreality, dear, needs, elsewhere, embed, etc, give, free, geared, towards, fandom, stop, blocked, rather, than, acquiesce, internet, safety, laws, which, hold, against, mean, pictures, show, purple, boxes, deleted, dec, frightfullytreeish, incredible, lucainthesky, perfect, honest, ive, drawn, anything, before, adore, melanchovy, 641, 942, draw, camdrawstuff, design, pink, lantern, l0adingout, 302, anyways, enjoy, extra, side, doodles, see, bitches, dancing, gala, suing, 546, 122, pissing, each, off, artandbrimstone, 216, reread, decided, experiment, style, drawing, queercannibal, 181, 185, slight, dick, cementery, fateful, night, 683, 421, 426, following, likes, posts, words, brainrot, rotting, spilt, marvel, dudes, spin, fire, log, sign, palette, communities, explore,

Text of the page (random words):
sp1n dle on tumblr explore communities change palette sign up log in spin s dumpster fire ᘛ ̤ ᕐ ᐷ sp1n dle the brainrot is rotting someone spilt dc and marvel in there he they my dudes words ️ ️ follow posts likes following sp1n dle reblogged 3d onyxmistkes 4d follow i miss them guys 10 39 426 sp1n dle reblogged may 11 va nnahs mar 12 follow part 2 of this comic 32 1 421 11 683 sp1n dle reblogged may 11 va nnahs mar 8 follow in another universe slight things change and dick finds himself in the cementery one fateful night 50 2 185 11 181 sp1n dle reblogged may 8 queercannibal may 6 follow reread existential crisis mode by luciaintheskyainthi and decided to experiment with a new art style by drawing jason and peter 11 21 216 sp1n dle reblogged apr 25 artandbrimstone apr 24 follow if dc won t make a comic of them pissing each other off then i will 6 122 546 sp1n dle reblogged mar 25 onyxmistkes mar 24 follow if i do not see these bitches dancing at the gala i will be suing but anyways enjoy the extra little side doodles reference one reference two 6 21 302 sp1n dle reblogged luciaintheskyainthi mar 18 l0adingout mar 14 follow camdrawstuff s design of if jason was a pink lantern i thought it was sick and had to draw it 14 942 7 641 sp1n dle reblogged mar 17 melanchovy mar 17 follow ive never drawn anything for a fic before but i just had to make some existential crisis mode fanart i adore them please read it it s an incredible fic by lucainthesky just perfect to be honest 2 6 sp1n dle reblogged luciaintheskyainthi mar 15 frightfullytreeish dec 25 2025 follow dear everyone on tumblr who needs to host images elsewhere e g to embed on ao3 etc please give squidge a go it s free it s nonprofit and it s geared towards fandom so nsfw images won t get deleted and please stop using imgur if you can because they blocked the uk rather than acquiesce to the fucking internet safety laws which i can t really hold against em but it does mean all imgur pictures just show up as big purple boxes now blogquantumreality feb 7 squidge holy blast from the past batman the last time i remember even looking at that site was eons ago oh what was i reading the quartz key yes it s m m beatrice otter feb 9 not only is squidge still around it s expanded and grown it is still run by the same guy though now it s a nonprofit with a board and everything and while they maintain all the old squidge sites as static archives they have a new multifandom archive using the ao3 code at squidgeworld org they also host podfics and fanart for those younguns in the crowd back in the day erotic fanworks especially slash was not welcome very many places walter was willing to host it and has been a haven for nsfw fanworks since 1994 the various archives and so on hosted at squidge org were never very large compared to lots of other archives but they were a necessary part of the fannish ecosystem and i m really glad that there is now a structure in place to keep the whole system running beyond just walter s a great guy willing to donate lots of time and money walter is a great guy but like it s good to have other people to help out and keep things going in the long run stargazing enby mar 6 it s what i use can recommend 11 3 837 5 440 sp1n dle reblogged mar 15 hazzymayy mar 15 follow hour of delusion 14 288 2 982 sp1n dle mar 12 listening to never let me down again by depeche mode and having jayroy thoughts 10 10 experience would recommend jayroy in a depeche mode kick at the moment we ball spotify 5 sp1n dle reblogged feb 28 onyxmistkes feb 24 follow volume warning i am supposed to be preparing for a presentation i have tomorrow it s fucking 5 am there is no more tomorrow that shit is today but instead i wanted to practice my lip syncing inspired by existential crisis mode written by luciaintheskyainthi 9 116 878 sp1n dle reblogged feb 23 onyxmistkes feb 22 follow he s sick of their dumbassary as we all are inspired by existential crisis mode written by luciaintheskyainthi 3 73 821 sp1n dle reblogged feb 10 lilsnuffklins feb 8 follow hallucination jaybin 7 473 3 328 sp1n dle reblogged jan 31 cosmaris jan 31 follow jason todd x peter parker masterlist complete ongoing 10 10 fanfic please read friendly neighborhood spider mechanic 36k when peter parker ends up in gotham city a world straight out of a comic book only to find out that he s the one who s a comic book character he decides to lay low don t be a hero just create a new civilian identity as peter anthony mayson and live and it works until one day he somehow catches red hood s attention and jason todd wayne crashes his way into his mundane life leaving cracks in peter s fragile mask of normality 2 the big bad red riding hood and the friendly neighborhood spider 107k red hood s the name peter mulled the name over turning it in his mind like legally the man s pride deflated quickly no not legally or a fic where peter was found unconscious and injured in a dumpster by jason after accidentally inventing multiverse travel instead of time travel he doesn t know how he did it but he did 3 spider webs and rocket lunchers 59k peter just wants someone to acknowledge his existence to look him in the eye and say peter parker exists so when he tries to tell his friends team red his name its not surprising when it all goes to shit damn his parker luck and damn doctor strange though maybe getting sent to another universe isn t all bad maybe he can build a new life for himself one with his real name and this cute guy that visits the bar he works at 4 existential crisis mode 279k peter was alone mid way through an existential crisis after the erasure and was dreading the upcoming month of may jason was sick of people telling him how he felt you don t need us anymore artemis had told him as if saying it would make it true as if jason needed someone to justify keeping them around but three weeks back in gotham and all jason felt was fucking bored and lonely it was a relief then when some random new yorker was thrown into his living room through a portal straight out of some lsd daydream finally something interesting to deal with cue some wild family misunderstandings criminal conspiracies and cults because there s always a goddamn cult 5 the study of the spider man 19k sexual dimorphism the difference between different sexes of the same species in spiders the females are always larger so when one quarter spider man sees red hood for the first time every instinct in his little spider brain is screaming mate at him red hood suffers the consequences for it and the batfam are laughing at his pain 6 shutterbug 131k waking up peter finds him self in a new city and no memory of how he got there the question is where is gotham and how did he get there little does he know that his new photographer job will lead him to making new friend and maybe something more join peter as he takes on gotham and its rouges not to mention finding his place as a spider in the mists of bats and birds 7 red flags and webbed disasters 20k jason has a problem a red blue and spider shaped problem it starts with an accidental trip to new york a mid air near miss with spider man and an argument that definitely doesn t end with jason admitting the bug has good reflexes then deadpool shows up decides jason is team red material and refuses to take no for an answer and just when jason thinks things cannot get more annoying he meets peter parker clumsy dorky weirdly strong peter parker now jason has two problems 8 caught 20k jason todd is just trying to do his best for crime alley while managing his criminal enterprise with his team he wasn t expecting to invite the cute wickedly smart new tenant to work with him but well his life has always been a series of surprises 9 fixing for a living 83k it wasn t enough to erase peter parker from everyone s minds magic like that doesn t last forever so to ensure the universe won t break again in the future peter was sent away far from the place he called home where peter starts over in a new universe his life is flipped upside down but one thing stays with him his ability to fix things let s just say he takes the whole fixing a little too far 10 another child assassin 59k deception is all he knows killing is all he knows emotions were one s downfall so what happens when peter is thrown into a world and meets people that try to change that will he let them 13 95 sp1n dle reblogged jan 28 jiloop jan 25 follow just roomates totally it s been a while since i ve art of these losers i had a lot of fun with the colors existential crisis mode luciaintheskyainthi 7 53 618 sp1n dle reblogged ra1nydayss jan 21 amerlcanapparel deactivated2020 when she says she doesn t send nudes straighthater mar 3 2014 when guys objectify women and expect them to send nudes timelordpillbug mar 3 2014 when someone asks you about your nuclear plans for russia hikingnerd mar 4 2014 when russia sends you nudes dr thackery mar 8 2014 dismantlerepaired mar 12 2014 ilovepretzelrods mar 18 2014 thegingerbalrog mar 19 2014 onwardwall mar 20 2014 miss jaxon flaxon waxon apr 7 2014 what the fuck happened here her eyes dared me with danger oct 27 2014 this is my favorite post in all of tumblr kyloschuyler apr 17 2015 reminder that this post is now illegal in russia tree of blue squirrel apr 21 2017 reblog it because russia can t maradaisykat aug 22 2017 thanks obama my sisters eyeball jan 6 2019 wtf roomba with knives taped to it mar 3 2019 when russia makes this post illegal earthnicity jun 13 2019 i have only seen this in screenshots dovahdez jun 20 2019 i will reblog this every goddamn time i find it on my dash a wondering thought deactivated i have a piece of tumblr history on my blog now hellsitegenetics oct 28 2025 string identified atgctactttaatcaaaaattcatattattatttgaagtcaacattaaataattgaatctgtgattaaacttg closest match bombyx mori bmn4 cell dna chromosome 24 sequence common name domestic silk moth image source willifolts oct 28 2025 when the domestic silk moth sends you nudes gif by kalazin scp threats is back oct 28 2025 domestic silk moth is just being friendly yoink a doink oct 28 2025 now the moth is banned in russia fantasylover4538 oct 28 2025 well what the fuck is this kingofkaumidy2 art shower thoughts last responder nov 4 2025 922 2 352 772 1 389 702 you are using an unsupported browser and things might not work as intended please make sure you re using the latest version of chrome firefox safari or edge